ecliptic phluorin Search Results


ecliptic phluorin  (Addgene inc)
93
Addgene inc ecliptic phluorin
(a) Top: diagram depicting oligodendrocyte differentiation in culture; bottom: transfection of oligodendrocyte precursors with <t>pHluorin-tagged</t> VAMP2 or VAMP3 to visualize exocytosis. (b) Representative image of a pre-myelinating oligodendrocyte expressing VAMP2-pHluorin. Montage shows an exocytotic event over time, and the corresponding plot of intensity vs. time shows the characteristic fluorescent increase and decay (fitted by the green dotted line). (c) Frequency of VAMP2- or VAMP3-pHluorin events localized to the soma or to the processes/sheets in cultured rat oligodendrocyte precursors (gray), pre-myelinating (yellow), or mature oligodendrocytes (magenta). Each pair of points connected by a line shows events for one cell. See Supplementary Table 1 for average event frequencies + SEM. Statistical significance was determined using the mean of each biological replicate (n = 3) by an ordinary one-way ANOVA with Tukey correction for multiple comparisons. (d) Top: representative images of oligodendrocyte-lineage cells expressing VAMP2-pHluorin in the larval zebrafish spinal cord. Bottom: examples of VAMP2 exocytotic events within oligodendrocyte processes and sheaths. (e) Frequency of VAMP2- or VAMP3-pHluorin events in oligodendrocytes of the zebrafish spinal cord localized to the soma or to the processes/sheaths in precursors/pre-myelinating (yellow), early myelinating (pale pink), or mature oligodendrocytes (magenta). Each pair of points connected by a line shows events for one cell (typically from one fish). See Supplementary Table 2 for average event frequencies + SEM. Statistical significance was determined by an ordinary one-way ANOVA with Tukey correction for multiple comparisons. (f) Spatial frequency of VAMP2 and VAMP3 exocytotic events within myelin sheaths, where the paranode is defined as 3 μm from the sheath edge . The measured frequencies at paranodes (mean + SEM) were (50 + 22.4)% for VAMP2 and (24.9 + 12.7)% for VAMP3, each with n = 25 sheaths from 5 experiments. See Supplementary Table 3.
Ecliptic Phluorin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ecliptic+phluorin/bio_rxiv__2022__07__08__498895-306-13-17?v=Addgene+inc
Average 93 stars, based on 1 article reviews
ecliptic phluorin - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier
super-ecliptic phluorin cassette  (GenScript corporation)
90
GenScript corporation super-ecliptic phluorin cassette
(a) Top: diagram depicting oligodendrocyte differentiation in culture; bottom: transfection of oligodendrocyte precursors with <t>pHluorin-tagged</t> VAMP2 or VAMP3 to visualize exocytosis. (b) Representative image of a pre-myelinating oligodendrocyte expressing VAMP2-pHluorin. Montage shows an exocytotic event over time, and the corresponding plot of intensity vs. time shows the characteristic fluorescent increase and decay (fitted by the green dotted line). (c) Frequency of VAMP2- or VAMP3-pHluorin events localized to the soma or to the processes/sheets in cultured rat oligodendrocyte precursors (gray), pre-myelinating (yellow), or mature oligodendrocytes (magenta). Each pair of points connected by a line shows events for one cell. See Supplementary Table 1 for average event frequencies + SEM. Statistical significance was determined using the mean of each biological replicate (n = 3) by an ordinary one-way ANOVA with Tukey correction for multiple comparisons. (d) Top: representative images of oligodendrocyte-lineage cells expressing VAMP2-pHluorin in the larval zebrafish spinal cord. Bottom: examples of VAMP2 exocytotic events within oligodendrocyte processes and sheaths. (e) Frequency of VAMP2- or VAMP3-pHluorin events in oligodendrocytes of the zebrafish spinal cord localized to the soma or to the processes/sheaths in precursors/pre-myelinating (yellow), early myelinating (pale pink), or mature oligodendrocytes (magenta). Each pair of points connected by a line shows events for one cell (typically from one fish). See Supplementary Table 2 for average event frequencies + SEM. Statistical significance was determined by an ordinary one-way ANOVA with Tukey correction for multiple comparisons. (f) Spatial frequency of VAMP2 and VAMP3 exocytotic events within myelin sheaths, where the paranode is defined as 3 μm from the sheath edge . The measured frequencies at paranodes (mean + SEM) were (50 + 22.4)% for VAMP2 and (24.9 + 12.7)% for VAMP3, each with n = 25 sheaths from 5 experiments. See Supplementary Table 3.
Super Ecliptic Phluorin Cassette, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ecliptic+phluorin/pmc06135592-403-27-32?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
super-ecliptic phluorin cassette - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
ecliptic phluorin fluorescent protein 4  (GenScript corporation)
90
GenScript corporation ecliptic phluorin fluorescent protein 4
(a) Top: diagram depicting oligodendrocyte differentiation in culture; bottom: transfection of oligodendrocyte precursors with <t>pHluorin-tagged</t> VAMP2 or VAMP3 to visualize exocytosis. (b) Representative image of a pre-myelinating oligodendrocyte expressing VAMP2-pHluorin. Montage shows an exocytotic event over time, and the corresponding plot of intensity vs. time shows the characteristic fluorescent increase and decay (fitted by the green dotted line). (c) Frequency of VAMP2- or VAMP3-pHluorin events localized to the soma or to the processes/sheets in cultured rat oligodendrocyte precursors (gray), pre-myelinating (yellow), or mature oligodendrocytes (magenta). Each pair of points connected by a line shows events for one cell. See Supplementary Table 1 for average event frequencies + SEM. Statistical significance was determined using the mean of each biological replicate (n = 3) by an ordinary one-way ANOVA with Tukey correction for multiple comparisons. (d) Top: representative images of oligodendrocyte-lineage cells expressing VAMP2-pHluorin in the larval zebrafish spinal cord. Bottom: examples of VAMP2 exocytotic events within oligodendrocyte processes and sheaths. (e) Frequency of VAMP2- or VAMP3-pHluorin events in oligodendrocytes of the zebrafish spinal cord localized to the soma or to the processes/sheaths in precursors/pre-myelinating (yellow), early myelinating (pale pink), or mature oligodendrocytes (magenta). Each pair of points connected by a line shows events for one cell (typically from one fish). See Supplementary Table 2 for average event frequencies + SEM. Statistical significance was determined by an ordinary one-way ANOVA with Tukey correction for multiple comparisons. (f) Spatial frequency of VAMP2 and VAMP3 exocytotic events within myelin sheaths, where the paranode is defined as 3 μm from the sheath edge . The measured frequencies at paranodes (mean + SEM) were (50 + 22.4)% for VAMP2 and (24.9 + 12.7)% for VAMP3, each with n = 25 sheaths from 5 experiments. See Supplementary Table 3.
Ecliptic Phluorin Fluorescent Protein 4, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ecliptic+phluorin/pm29672020__am8b02717_si_001-25-1-9?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
ecliptic phluorin fluorescent protein 4 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
super ecliptic phluorin  (Twist Bioscience)
86
Twist Bioscience super ecliptic phluorin
(a) Top: diagram depicting oligodendrocyte differentiation in culture; bottom: transfection of oligodendrocyte precursors with <t>pHluorin-tagged</t> VAMP2 or VAMP3 to visualize exocytosis. (b) Representative image of a pre-myelinating oligodendrocyte expressing VAMP2-pHluorin. Montage shows an exocytotic event over time, and the corresponding plot of intensity vs. time shows the characteristic fluorescent increase and decay (fitted by the green dotted line). (c) Frequency of VAMP2- or VAMP3-pHluorin events localized to the soma or to the processes/sheets in cultured rat oligodendrocyte precursors (gray), pre-myelinating (yellow), or mature oligodendrocytes (magenta). Each pair of points connected by a line shows events for one cell. See Supplementary Table 1 for average event frequencies + SEM. Statistical significance was determined using the mean of each biological replicate (n = 3) by an ordinary one-way ANOVA with Tukey correction for multiple comparisons. (d) Top: representative images of oligodendrocyte-lineage cells expressing VAMP2-pHluorin in the larval zebrafish spinal cord. Bottom: examples of VAMP2 exocytotic events within oligodendrocyte processes and sheaths. (e) Frequency of VAMP2- or VAMP3-pHluorin events in oligodendrocytes of the zebrafish spinal cord localized to the soma or to the processes/sheaths in precursors/pre-myelinating (yellow), early myelinating (pale pink), or mature oligodendrocytes (magenta). Each pair of points connected by a line shows events for one cell (typically from one fish). See Supplementary Table 2 for average event frequencies + SEM. Statistical significance was determined by an ordinary one-way ANOVA with Tukey correction for multiple comparisons. (f) Spatial frequency of VAMP2 and VAMP3 exocytotic events within myelin sheaths, where the paranode is defined as 3 μm from the sheath edge . The measured frequencies at paranodes (mean + SEM) were (50 + 22.4)% for VAMP2 and (24.9 + 12.7)% for VAMP3, each with n = 25 sheaths from 5 experiments. See Supplementary Table 3.
Super Ecliptic Phluorin, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ecliptic+phluorin/bio_rxiv__64898__2026__04__24__720392-87-11-19?v=Twist+Bioscience
Average 86 stars, based on 1 article reviews
super ecliptic phluorin - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

Image Search Results


(a) Top: diagram depicting oligodendrocyte differentiation in culture; bottom: transfection of oligodendrocyte precursors with pHluorin-tagged VAMP2 or VAMP3 to visualize exocytosis. (b) Representative image of a pre-myelinating oligodendrocyte expressing VAMP2-pHluorin. Montage shows an exocytotic event over time, and the corresponding plot of intensity vs. time shows the characteristic fluorescent increase and decay (fitted by the green dotted line). (c) Frequency of VAMP2- or VAMP3-pHluorin events localized to the soma or to the processes/sheets in cultured rat oligodendrocyte precursors (gray), pre-myelinating (yellow), or mature oligodendrocytes (magenta). Each pair of points connected by a line shows events for one cell. See Supplementary Table 1 for average event frequencies + SEM. Statistical significance was determined using the mean of each biological replicate (n = 3) by an ordinary one-way ANOVA with Tukey correction for multiple comparisons. (d) Top: representative images of oligodendrocyte-lineage cells expressing VAMP2-pHluorin in the larval zebrafish spinal cord. Bottom: examples of VAMP2 exocytotic events within oligodendrocyte processes and sheaths. (e) Frequency of VAMP2- or VAMP3-pHluorin events in oligodendrocytes of the zebrafish spinal cord localized to the soma or to the processes/sheaths in precursors/pre-myelinating (yellow), early myelinating (pale pink), or mature oligodendrocytes (magenta). Each pair of points connected by a line shows events for one cell (typically from one fish). See Supplementary Table 2 for average event frequencies + SEM. Statistical significance was determined by an ordinary one-way ANOVA with Tukey correction for multiple comparisons. (f) Spatial frequency of VAMP2 and VAMP3 exocytotic events within myelin sheaths, where the paranode is defined as 3 μm from the sheath edge . The measured frequencies at paranodes (mean + SEM) were (50 + 22.4)% for VAMP2 and (24.9 + 12.7)% for VAMP3, each with n = 25 sheaths from 5 experiments. See Supplementary Table 3.

Journal: bioRxiv

Article Title: CNS myelination requires VAMP2/3-mediated membrane expansion in oligodendrocytes

doi: 10.1101/2022.07.08.498895

Figure Lengend Snippet: (a) Top: diagram depicting oligodendrocyte differentiation in culture; bottom: transfection of oligodendrocyte precursors with pHluorin-tagged VAMP2 or VAMP3 to visualize exocytosis. (b) Representative image of a pre-myelinating oligodendrocyte expressing VAMP2-pHluorin. Montage shows an exocytotic event over time, and the corresponding plot of intensity vs. time shows the characteristic fluorescent increase and decay (fitted by the green dotted line). (c) Frequency of VAMP2- or VAMP3-pHluorin events localized to the soma or to the processes/sheets in cultured rat oligodendrocyte precursors (gray), pre-myelinating (yellow), or mature oligodendrocytes (magenta). Each pair of points connected by a line shows events for one cell. See Supplementary Table 1 for average event frequencies + SEM. Statistical significance was determined using the mean of each biological replicate (n = 3) by an ordinary one-way ANOVA with Tukey correction for multiple comparisons. (d) Top: representative images of oligodendrocyte-lineage cells expressing VAMP2-pHluorin in the larval zebrafish spinal cord. Bottom: examples of VAMP2 exocytotic events within oligodendrocyte processes and sheaths. (e) Frequency of VAMP2- or VAMP3-pHluorin events in oligodendrocytes of the zebrafish spinal cord localized to the soma or to the processes/sheaths in precursors/pre-myelinating (yellow), early myelinating (pale pink), or mature oligodendrocytes (magenta). Each pair of points connected by a line shows events for one cell (typically from one fish). See Supplementary Table 2 for average event frequencies + SEM. Statistical significance was determined by an ordinary one-way ANOVA with Tukey correction for multiple comparisons. (f) Spatial frequency of VAMP2 and VAMP3 exocytotic events within myelin sheaths, where the paranode is defined as 3 μm from the sheath edge . The measured frequencies at paranodes (mean + SEM) were (50 + 22.4)% for VAMP2 and (24.9 + 12.7)% for VAMP3, each with n = 25 sheaths from 5 experiments. See Supplementary Table 3.

Article Snippet: We then generated a Gateway-compatible 3’-entry vector containing 4 tandem copies of super ecliptic pHluorin, using pcDNA3-SypHluorin4x (Addgene #37005) as a template for PCR and primers 5’-GGGGACAGCTTTCTTGTACAAAGTGG TCCCCCATGGATCTAGCCACC ATGG -3’ (attB2-(linker)4xpHluorin F, linker region underlined and pHluorin coding sequence in bold) and 5’-GGGGACAACTTTGTATAATAAAGTTGT TTA CGATAAGCTTGATCGAGCTCCA -3’ (attB3R-4xpHluorin R, terminal linker underlined and stop codon in bold) to amplify an attB-containing product, and recombining it with pDONRP2RP3 using BP clonase II.

Techniques: Transfection, Expressing, Cell Culture